Sequences
Below is an overview of the sequences that are included within the database grouped by component, telomerase RNA (TR), reverse transcriptase (TERT), associated proteins, and the telomere sequences. The sequences are further organized by taxon. The genbank accession numbers are linked to the record at the National Center for Biotechnology Information (NCBI). The headings of each table are linked to additional pages within the database detailing each sequence. The GC% content is not provided for putative/partial sequences. The GC% content has been adjusted, where necessary, to account for any adjustment to the 5' or 3' ends compared to the NCBI record, numbers in parentheses. The headings at the top of each table are linked to more detailed information for sequence for the particular telomerase component. The heading is omitted, in white, where there are currently no known sequences.
Vertebrates TR TERT Others components Telomere sequences
mammals
Homo sapiens (human) hEst1A TTAGGG
hEst1B
hGar1p
hNhp2
hNop10
dyskerin
SMN
14-3-3
Ku
La
Nucleolin
PinX1
Hsp90
Hsp23
KIP
knRNP A1
hnRNP C1/C2
hnRNP D
L22
hStau
Pan troglodytes (chimpanzee)
XM_001141571 (predicted) TTAGGG
XM_001141663 (predicted)
XM_526823 (predicted)
Macaca mulatta (rhesus monkey)
XM_001096791 (predicted)
TTAGGG
Tupaia glis belangeri (common tree shrew)
TTAGGG
Oryctolagus cuniculus (domestic rabbit)
DQ399677 (TERT-like mRNA)
TTAGGG
Cavia porcellus (domestic guinea pig)
TTAGGG
Chinchilla brevicaudata (short-tailed chinchilla)
TTAGGG
Geomys breviceps (gopher)
TTAGGG
Microtus ochrogaster (prairie vole)
TTAGGG
Cricetulus griseus (Chinese hamster)
TTAGGG
Mesocricetus auratus (golden Syrian hamster)
TTAGGG
Mus musculus (mouse) TTAGGG
Mus spretus (western wild mouse)
TTAGGG
Mus musculus castaneus (Asian house mouse)
TTAGGG
Rattus norvegicus (Norway rat) TTAGGG
Canis familiaris (dog)
TTAGGG
Mustela putorius furo (domestic ferret)
TTAGGG
Procyon lotor (raccoon)
TTAGGG
Felis catus (cat)
AB094676 (partial sequence)
TTAGGG
Bos taurus (cattle) TTAGGG
Muntiacus muntjak vaginalis (barking deer)
AY760074 (partial sequence)
TTAGGG
Sus scrofa (pig) AY785158 (partial sequence) TTAGGG
AF221942 (pseudogene)
Suncus murinus (Asian house shrew)
TTAGGG
Equus caballus (domestic horse)
TTAGGG
Dasypus novemcinctus (armadillo)
TTAGGG
Dasyurus hallucatus (northern quoll)
TTAGGG
Monodelphis domestica (gray opossum)
XM_001369395 (predicted)
TTAGGG
Elephas maximus (Asian elephant)
TTAGGG
Trichechus manatus (Caribbean manatee)
TTAGGG
birds
Anas platyrhynchos (mallard ducks)
DQ681293 (partial sequence)
TTAGGG
Coturnix japonica (Japanese quail)
TTAGGG
Gallus gallus (chicken)
TTAGGG
Anodorhynchus hyacinthinus (macaw)
TTAGGG
  Chelydra serpentina (snapping turtle)
TTAGGG
amphibians
Bombina japonica (toad)
TTAGGG
Xenopus laevis (African clawed frog) TTAGGG
Ceratophrys ornata (ornate horned frog)
TTAGGG
Pyxicephalus adspersus (bull frog)
TTAGGG
Dermophis mexicanus (Mexican caecilian)
TTAGGG
Herpele squalostoma (Congo caecilians)
TTAGGG
Typhlonectes natans (Rio Cauca caecilian)
TTAGGG
fish Oryzias latipes (Medaka) TTAGGG
Oryzias melastigma (Indian medaka)
TTAGGG
Nothobranchius furzeri (turquoise killifish) FJ167673 (GRZ) (partial) FJ167671 (GRZ) TTAGGG
FJ167674 (MZM-0403) (partial) FJ167672 (MZM-0403)
Gasterosteus aculeatus (stickleback)
TTAGGG
Epinephelus coioides (orange-spotted grouper)
TTAGGG
Takifugu rubripes (Fugu fish) TTAGGG
Tetraodon nigroviridis (green puffer fish)
CAAE01014577 (putative)
TTAGGG
Danio rerio (zebrafish) TTAGGG
Rhizoprionodon porosus (sharpnose shark)
TTAGGG
Mustelus canis (smooth dogfish shark)
TTAGGG
Dasyatis sabina (Atlantic stingray)
TTAGGG
Rhinoptera bonasus (cownose ray)
TTAGGG

Invertebrates TR TERT Other Components Telomere sequences
  Ciona intestinalis (sea squirt)
TTAGGG
Ciona savignyi (sea squirt)
TTAGGG
Oikopleura dioica (sea squirt)     TTAGGG
Botryllus schlosseri (star ascidian)     TTAGGG
  Strongylocentrotus purpuratus (purple sea urchin) TTAGGG
FJ615756 (long) additional .seq
  Donax trunculus (wedgeshell clam)
TTAGGG
Argopecten irradians (bay scallop)
TTAGGG
  Cassiopeidae sp. (jellyfish)     TTAGGG
  Gammarus pulex (freshwater shrimp)
TTAGG
beetles Stegobium paniceum (drugstore beetle)     TTAGG
Agrilus viridis (beetle)     TTAGG
Arhopalus coreanus (beetle)     TTAGG
Spondylis buprestoides (longhorn beetle)     TTAGG
Leptinotarsa decemlineata (Colorado potato beetle)     TTAGG
Ips typographus (Spruce bark beetle)     TTAGG
Graphoderus cinereus (beetle)     TTAGG
Ampedus sanguineus (beetle)     TTAGG
Diacanthous undosus (beetle)     TTAGG
Melanotus legatus (click beetle)     TTAGG
Mylabris sp.     TCAGG
Typhaea stercorea     TCAGG
Silpha obscura (beetle)     TTAGG
Oryzaephilus surinamensis (grain beetle)     TTAGG
Palorus ratzeburgii (small-eyed flour beetle)     TCAGG
Palorus subdepressus     TCAGG
Palorus genalis     TCAGG
Palorus ficicola     TCAGG
Pimelia elevata     TCAGG
Pimelia criba     TCAGG
Pimelia monticola     TCAGG
Tenebrio molitor (yellow mealworm)     TCAGG
Tenebrio obscurus     TCAGG
Tribolium castaneum (red flour beetle)   NM_001040706 TCAGG
Tribolium freemani     TCAGG
Tribolium confusum     TCAGG
Tribolium madens     TCAGG
Tribolium audax     TCAGG
Tribolium brevicornis     TCAGG
Tribolium anaphe     TCAGG
Tribolium destructor     TCAGG
flies Chironomus tentans (fly)     satellite sequence
Anopheles gambiae (African malaria mosquito)     unequal recombination
Drosophila melanogaster (fruit fly)     retrotransposons
Drosophila virilis (fly)     retrotransposons satellite sequence
  Apis mellifera (honey bee)   TTAGG
Manica yessensis (ant)     TTAGG
Myrmecia sp. (ant)     TTAGG
Tapinoma nigerrimum (ant)     TTAGG
Lepidopterans Bombyx mori (domestic silkworm)   TTAGG
Bombyx mandarina (wild silkworm)   TTAGG
Mamestra brassicae (cabbage moth)     TTAGG
Papilio xuthus (butterfly)     TTAGG
Ephestia kuehniella (Mediterranean flour moth)     TTAGG
Galleria mellonella (wax moth)     TTAGG
Antheraea pernyi (Chinese oak silkmoth)     TTAGG
Antheraea yamamai (Japanese oak silkmoth)     TTAGG
Samia cynthia ricini (Indian silkmoth)     TTAGG
Agrius convolvuli (morning glory sphinx moth)     TTAGG
  Sialis lutaria (alderfly)     TTAGG
  Stenopsyche japonica (caddisfly)     TTAGG
Limnephilus decipiens (caddisfly)     TTAGG
  Protidricerus japonicus (owlfly)     TTAGG
  Periplaneta fuliginosa (dusky-brown cockroach)     TTAGG
  Hodotermopsis japonicus (termite)     TTAGG
  Locusta migratoria (migratory locust)     TTAGG
Diestrammena japonica (camel cricket)     TTAGG
nematodes Ascaris lumbricoides (common roundworm)
TTAGGC
Ascaris suum (pig round worm)     TTAGGC
Parascaris univalens
TTGCA
Caenorhabditis elegans
TTAGGC
NM_059973 (N' truncation)
Caenorhabditis remanei
 
Caenorhabditis briggsae
CAE66970 (draft sequence)
 

Fungi TR TERT Others components Telomere sequences
  Schizosaccharomyces pombe (fission yeast) EU239354 SpEst1 G2–8TTAC(A)
Saccharomycotina Saccharomyces cerevisiae (baker's yeast) S288
NC_001134 (11-1168)
Est1p T(G)2-3(TG)1-6
Est3p
Ku
Cdc13p
Sm proteins
PinX1/
Gno1p
Saccharomyces pastorianus (lager yeast)
Saccharomyces kudriavzevii
Saccharomyces cariocanus
Saccharomyces bayanus T(G)2-3(TG)1-6
Saccharomyces paradoxus T(G)2-3(TG)1-6
Saccharomyces mikatae T(G)2-3(TG)1-6
Saccharomyces exiguus     T(G)2-3(TG)1-6
Saccharomyces dairenensis     TCTGGG(TG)1-3
TCTGGGTG
Saccharomyces castellii     TCTGGGTG
Saccharomyces kluyveri     GGGTGGACATGCGTACTGTGAGGTCT
Kluyveromyces lactis ACGGATTTGATTAGGTATGTGGTGT
Kluyveromyces wickerhamii
Kluyveromyces nonfermentans
Kluyveromyces marxianus
AY151279 (118-1633)
Kluyveromyces dobzhanskii
Kluyveromyces aestuarii
Candida albicans ACGGATGTCTAACTTCTTGGTGT
Candida glabrata
NC_006032 (668084-670574)
XM_444808 (hypothetical)
CTGGGTGCTGTGGGGT
Candida guillermondii ACTGGTGT
Candida maltosa ACGGATGCAGACTCGCTTGGTGT
Candida metapsilosis GGTTAGGATGTCCAAAGTATTGA
Candida orthopsilosis GGTTAGGATGTAGACAATACTGC
Candida parapsilosis GGTCCGGATGTTGATTATACTGA
Candida pseudotropicalis ACGGATTTGATTAGTTATGTGGTGT
Candida sojae TGTAAGGATGCAAAACCGCTATTCG
Candida tropicalis AC/AGGGATGTCACGATCATTGGTTGT
AAGGATGTCACGATCATTGGTGT
Debaryomyces hansenii
XM_458163 (hypothetical)
ATGTTGAGGTGTAGGG
Ashbya gossypii (Eremothecium gossypii)
GTGTGGTGTATGGGTCTCTCAGCG
Lodderomyces elongisporus
XM_001528127 (hypothetical)
CGGTGTAAGGATGCACTTGAAACT
Pichia guilliermondii
XM_001482068 (hypothetical)
ACTGGTGT
Pichia stipitis     GGATCTTTTCACGTCTTGCGGTA
Yarrowia lipolytica
XM_502732 (hypothetical)
GGACGATTG
Clavispora lusitaniae     TCTTTAGGGAGGTACTGATGT
Pezizomycotina Aspergillus fumigatus
TTAGGG
Aspergillus oryzae
AP007151 (partial sequence)
TTAGGGTCAACA
Aspergillus clavatus
 
Aspergillus niger
XM_001396218 (hypothetical)
 
Aspergillus nidulans
XM_656265 (hypothetical)
TTAGGG
Aspergillus terreus
XM_001213525 (hypothetical)
Neosartorya fischeri
 
Histoplasma capsulatum
TTAGGG
Coccidioides immitis
XM_001240369 (hypothetical)
 
Cladosporium fulvum
TTAGGG
Gibberella zeae
XM_381218 (hypothetical)
 
Magnaporthe grisea (rice blast fungus)
XM_363691 (hypothetical)
TTAGGG
Chaetomium globosum
XM_001220720 (hypothetical)
Podospora anserina
TTAGGG
Neurospora crassa
XM_958854 (hypothetical)
TTAGGG
Talaromyces stipitatus
XM_002482751 (putative)
 
  Coprinopsis cinerea
AACS01000191 (hypothetical)
Cryptococcus neoformans
TTA(G)4-6
Ustilago maydis
XM_751815 (hypothetical)
 
  Encephalitozoon cuniculi
G[A/GGCCT[C/T]CT
GAGCCTTGTTT
GAGACGCAGTGTTGCCAGGATG
mold
Dictyostelium discoideum
XM_628870 (hypothetical)
AG1-8
Physarum polycephalum
TTAGGG
Didymium iridis
TTAGGG
* The Genbank records have been adjusted for the 5’ and 3’ ends, numbers in parentheses.

Plants TR TERT Other Components Telomere sequences
eudicots Nicotiana tabacum (common tobacco)
TTAGGG
Solanum lycopersicum (tomato)
TT[T/A]GGG
Strombosia pustulata (Italian olive ash)     TTTTGGGG
Arabidopsis thaliana (thale cress) HQ401284 (TER1) (partial) TTTAGGG
HQ401285 (TER2) (partial)
monocots Aloe sp.
TTAGGG
Doryanthes excelsa (Gymea lily)
 
Hosta rectifolia (day lily)
AY850586 (partial sequence)  
Muscari armeniacum (grape hyacinth)
DQ073065 (partial sequence)
 
Ornithogalum virens (hyacinth)
AY850597 (partial sequence)
 
Scilla peruviana (Peruvian jacinth)
AY818158 (partial sequence)
 
Iris tectorum (Japanese roof Iris)
 
Phragmipedium longifolium
DQ073072 (partial sequence)
Oryza sativa (rice)
 
Hordeum vulgare (barley)
AY363163 (partial sequence)
 
Zea mays (maize)
 

Algae TR TERT Other Components Telomere sequences
  Galdieria sulphuraria (red algae)
Cyanidioschyzon merolae (red algae)
AATGGGGGG
  Chlamydomonas reinhardtii (green algae)
TTTTAGGG
Ostreococcus lucimarinus (green algae)
XM_001417260 (predicted)
Ostreococcus tauri (green algae)
 

Ciliates TR TERT Others components Telomere sequences
Oligohymenophorea
Glaucoma chattoni (no Genbank ID available)
TTGGGG
Glaucoma sp. ME60q
 
Tetrahymena thermophila p75 TTGGGG
p65
p45
p20
Tetrahymena malaccensis
(no Genbank ID available)
Tetrahymena pyriformis
(no Genbank ID available)
Tetrahymena vorax
Tetrahymena borealis
Tetrahymena silvana
Tetrahymena australis
Tetrahymena pigmentosa
(no Genbank ID available)
Tetrahymena hyperangularis
(no Genbank ID available)
Tetrahymena capricornis
Tetrahymena hegewischi
(no Genbank ID available)
Tetrahymena paravorax
Colpidium striatum
Colpidium colpoda
Colpidium campylum
Paramecium tetraurelia TT[T/G]GGG
Paramecium primaurelia
TT[T/G]GGG
U45435 (pseudo gene)
Paramecium multimicronucleatum
TT[T/G]GGG
Paramecium caudatum TT[T/G]GGG
Spirotrich
Euplotes aediculatus p43 TTTTGGGG
Euplotes eurystomus
AY303935 (partial sequence)
TTTTGGGG
Euplotes crassus
AY267543 (micronuclear)
TTTTGGGG
AY267544 (macronuclear)
Euplotes raikovi
AY303932 (partial sequence)  
Euplotes rariseta
AY303936 (partial sequence)
 
Euplotes minuta
AY303934 (partial sequence)
 
Euplotes vannus
AY303933 (partial sequence)
 
Oxytricha nova (Sterkiella nova)
TTTTGGGG
Oxytricha trifallax (Sterkiella histriomuscorum) TTTTGGGG
Stylonychia mytilis
Stylonychia lemnae

Other Protists TR TERT Other Components Telomere sequences
aplicomplexans Plasmodium falciparum (human parasite)
AL929357 (96976-98058)
(putative)
AX112155 (partial sequence)
TT[T/C]AGGG
Plasmodium vivax (human parasite)
(PlasmoDB) (putative)
XM_001617019 (hypothetical)
 
Plasmodium knowlesi (monkey parasite)
(PlasmoDB) (putative)
(PlasmoDB)
 
Plasmodium berghei (rodent parasite)
(PlasmoDB) (putative)
(PlasmoDB)
TT[T/C]AGGG
Plasmodium chabaudi chabaudi (rodent parasite)
(PlasmoDB) (putative)
XM_737184 (hypothetical)
 
Plasmodium yoelii yoelii (rodent parasite)
(PlasmoDB) (putative)
XM_719577 (hypothetical)
 
Plasmodium gallinaceum (chicken parasite)
(PlasmoDB) (putative)
   
Theileria annulata
XM_950122 (partial sequence)
TTTTAGGG
Cryptosporidium parvum AY034376 TTTAGG
Cryptosporidium hominis
XM_662704 (partial sequence)
 
Eimeria tenella GU271118  
Toxoplasma gondii
AM055943 (hypothetical)
 
  Giardia lamblia
XM_773419 (partial sequence)
TTAGG
Giardia intestinalis AF195121 TAGGG
kenetoplastids Leishmania braziliensis
AY268078 (partial sequence)
Leishmania major
AY232305 (partial sequence)
  TTAGGG
Leishmania donovani
AY780672 (partial sequence)
 
Leishmania amazonensis AY232307  
Leishmania infantum XM_001469585  
Trypanosoma cruzi
XM_814105 (partial sequence)
 
Trypanosoma brucei AY904042   TTAGGG
* The Genbank records have been adjusted for the 5’ and 3’ ends, numbers in parentheses.

  Viruses TR TERT Other Components Telomere Sequences
  MDV-1 (Marek’s disease alphaherpesvirus 1) RB1B AF331499 (160-601)      
MDV-2 (Marek’s disease alphaherpesvirus 2) GA AF147806 (246-691)      
Md5 AF243438 (1676-2117)      
RM-1
EF526179 (3436-3877)
(reverse complement)
     
* The Genbank records have been adjusted for the 5’ and 3’ ends, numbers in parentheses.