Telomere sequences
This page contains the major DNA tandem repeat sequence found within the telomere structures. Each sequence is referenced by original literature citations that are linked to the published online journal. The few species that do not utilize telomerase, certain insects, have the method of elongation listed in place of the tandem repeat. Most telomeric repeats are only 6 to 8 nucleotides, however several yeast species have irregular repeats that range from 6 to 26 nucleotides and contain other variant repeats.
  Vertebrates Sequences References
  vertebrate sp. TTAGGG Meyne et al, 1989

  Invertebrates Sequences References
  Ciona sp.(sea squirt) TTAGGG
Ciona savignyi (sea squirt) TTAGGG  
Oikopleura dioica (sea squirt) TTAGGG Schulmeister et al, 2007
Botryllus schlosseri (star ascidian) TTAGGG Laird and Weissman, 2004
  Strongylocentrotus purpuratus (purple sea urchin) TTAGGG Sinclair et al, 2007
  Donax trunculus (wedgeshell clam) TTAGGG Sinclair et al, 2007
Argopecten irradians (bay scallop) TTAGGG Sinclair et al, 2007
  Cassiopeidae sp. (jellyfish) TTAGGG Ojimi et al, 2008
  Gammarus pulex (freshwater shrimp) TTAGG Sahara et al, 1999
beetles Stegobium paniceum (drugstore beetle) TTAGG Frydrychová et al, 2004
Agrilus viridis (beetle) TTAGG Frydrychová et al, 2004
Arhopalus coreanus (beetle) TTAGG Okazaki et al, 1993
Spondylis buprestoides (longhorn beetle) TTAGG Okazaki et al, 1993
Leptinotarsa decemlineata (Colorado potato beetle) TTAGG Frydrychová et al, 2004
Ips typographus (Spruce bark beetle) TTAGG Sahara et al, 1999
Graphoderus cinereus (beetle) TTAGG Frydrychová et al, 2004
Ampedus sanguineus (beetle) TTAGG Frydrychová et al, 2004
Diacanthous undosus (beetle) TTAGG Okazaki et al, 1993
Melanotus legatus (click beetle) TTAGG Okazaki et al, 1993
Mylabris sp. TCAGG Mravinac et al, 2011
Typhaea stercorea TCAGG Mravinac et al, 2011
Silpha obscura (beetle) TTAGG Frydrychová et al, 2004
Oryzaephilus surinamensis (grain beetle) TTAGG Frydrychová et al, 2004
Palorus ratzeburgii (small-eyed flour beetle) TCAGG Mravinac et al, 2011
Palorus subdepressus TCAGG Mravinac et al, 2011
Palorus genalis TCAGG Mravinac et al, 2011
Palorus ficicola TCAGG Mravinac et al, 2011
Pimelia elevata TCAGG Mravinac et al, 2011
Pimelia criba TCAGG Mravinac et al, 2011
Pimelia monticola TCAGG Mravinac et al, 2011
Tenebrio molitor (yellow mealworm) TCAGG Mravinac et al, 2011
Tenebrio obscurus TCAGG Mravinac et al, 2011
Tribolium castaneum (red flour beetle) TCAGG
Tribolium freemani TCAGG Mravinac et al, 2011
Tribolium confusum TCAGG Mravinac et al, 2011
Tribolium madens TCAGG Mravinac et al, 2011
Tribolium audax TCAGG Mravinac et al, 2011
Tribolium brevicornis TCAGG Mravinac et al, 2011
Tribolium anaphe TCAGG Mravinac et al, 2011
Tribolium destructor TCAGG Mravinac et al, 2011
flies Chironomus tentans (fly) satellite sequence Nielsen et al, 1993
Anopheles gambiae (African malaria mosquito) unequal recombination Roth et al, 1997
Drosophila melanogaster (fruit fly) retrotransposons Biessmann et al, 1990
Drosophila virilis (fly) retrotransposons satellite sequence Frydrychová et al, 2004
  Apis mellifera (honey bee) TTAGG Sahara et al, 1999
Manica yessensis (ant) TTAGG Okazaki et al, 1993
Myrmecia sp. (ant) TTAGG Meyne et al, 1995
Tapinoma nigerrimum (ant) TTAGG Frydrychová et al, 2004
Lepidopterans Bombyx mori (domestic silkworm) TTAGG Okazaki et al, 1993
Bombyx mandarina (wild silkworm) TTAGG Okazaki et al, 1993
Mamestra brassicae (cabbage moth) TTAGG Frydrychová et al, 2004
Papilio xuthus (butterfly) TTAGG Frydrychová et al, 2004
Ephestia kuehniella (Mediterranean flour moth) TTAGG Sahara et al, 1999
Galleria mellonella (wax moth) TTAGG Sahara et al, 1999
Antheraea pernyi (Chinese oak silkmoth) TTAGG Okazaki et al, 1993
Antheraea yamamai (Japanese oak silkmoth) TTAGG Frydrychová et al, 2004
Samia cynthia ricini (Indian silkmoth) TTAGG Okazaki et al, 1993
Agrius convolvuli (morning glory sphinx moth) TTAGG Frydrychová et al, 2004
  Sialis lutaria (alderfly) TTAGG Frydrychová et al, 2004
  Stenopsyche japonica (caddisfly) TTAGG Okazaki et al, 1993
Limnephilus decipiens (caddisfly) TTAGG Frydrychová et al, 2004
  Protidricerus japonicus (owlfly) TTAGG Frydrychová et al, 2004
  Periplaneta fuliginosa (dusky-brown cockroach) TTAGG Okazaki et al, 1993
  Hodotermopsis japonicus (termite) TTAGG Okazaki et al, 1993
  Locusta migratoria (migratory locust) TTAGG Okazaki et al, 1993
Diestrammena japonica (camel cricket) TTAGG Okazaki et al, 1993
nematodes Ascaris lumbricoides TTAGGC Müller et al, 1991
Ascaris suum TTAGGC Teixeria et al, 2005
Parascaris univalens TTGCA Teschke et al, 1991
Caenorhabditis elegans TTAGGC Cangiano et al, 1993

  Fungi Sequences References
  Schizosaccharomyces pombe (fission yeast) G2–8TTAC(A)
Saccharomycotina Saccharomyces cerevisiae (baker's yeast) T(G)2-3(TG)1-6
Saccharomyces bayanus T(G)2-3(TG)1-6 Teixeria et al, 2005
Saccharomyces paradoxus T(G)2-3(TG)1-6 Teixeria et al, 2005
Saccharomyces mikatae T(G)2-3(TG)1-6 Teixeria et al, 2005
Saccharomyces exiguus T(G)2-3(TG)1-6 Cohn et al, 1998
Saccharomyces dairenensis TCTGGG(TG)1-3 Cohn et al, 1998
TCTGGG
Saccharomyces castellii TCTGGG(TG)1-4 Cohn et al, 1995
Saccharomyces kluyveri GGGTGGACATGCGTACTGTGAGGTCT Cohn et al, 1998
Kluyveromyces lactis ACGGATTTGATTAGGTATGTGGTGT McEachern and Blackburn, 1994
Candida albicans ACGGATGTCTAACTTCTTGGTGT McEachern and Blackburn, 1994
Candida glabrata CTGGGTGCTGTGGGGT McEachern and Blackburn, 1994
Candida guillermondii ACTGGTGT McEachern and Blackburn, 1994
Candida maltosa ACGGATGCAGACTCGCTTGGTGT McEachern and Blackburn, 1994
Candida metapsilosis GGTTAGGATGTCCAAAGTATTGA Gunisova et al, 2009
Candida orthopsilosis GGTTAGGATGTAGACAATACTGC Gunisova et al, 2009
Candida parapsilosis GGTCCGGATGTTGATTATACTGA Gunisova et al, 2009
Candida pseudotropicalis ACGGATTTGATTAGTTATGTGGTGT McEachern and Blackburn, 1994
Candida sojae TGTAAGGATGCAAAACCGCTATTCG Gunisova et al, 2009
Candida tropicalis A[C/A]GGATGTCACGATCATTGGTGT
AAGGATGTCACGATCATTGGTGT
Debaryomyces hansenii ATGTTGAGGTGTAGGG Lépingle et al, 2000
Ashbya gossypii (Eremothecium gossypii) GTGTGGTGTATGGGTCTCTCAGCG Dietrich et al, 2004
Lodderomyces elongisporus CGGTGTAAGGATGCACTTGAAACT Gunisova et al, 2009
Pichia guilliermondii ACTGGTGT Teixeria et al, 2005
Pichia stipitis GGATCTTTTCACGTCTTGCGGTA Jeffries et al, 2007
Yarrowia lipolytica GGACGATTG Teixeria et al, 2005
Clavispora lusitaniae TCTTTAGGGAGGTACTGATGT Gunisova et al, 2009
Pezizomycotina Aspergillus fumigatus TTAGGG Nierman et al, 2005
Aspergillus oryzae TTAGGGTCAACA Kusumoto et al, 2003
Aspergillus nidulans (Emericella nidulans) TTAGGG Bhattacharyya et al, 1997
Histoplasma capsulatum TTAGGG Woods et al, 1992
Cladosporium fulvum TTAGGG Coleman et al, 1993
Magnaporthe grisea (rice blast fungus) TTAGGG Teixeria et al, 2005
Podospora anserina TTAGGG Javerzat et al, 1993
Neurospora crassa TTAGGG Schechtman, 1990
  Cryptococcus neoformans (Filobasidiella neoformans) TTA(G)4-6 Edman, 1992
  Encephalitozoon cuniculi G[A/G]GCCT[C/T]CT Peyret et al, 2001
GAGCCTTGTTT
GAGACGCAGTGTTGCCAGGATG
  Rhizopus oryzae TTGTGG Ma et al, 2009
mold Dictyostelium discoideum A(G)1-8 Emery et al, 1981
Physarum polycephalum TTAGGG Forney et al, 1987
Didymium iridis TTAGGG Forney et al, 1987

  Plants Sequences References
  plants sp. TTTAGGG
eudicots Nicotiana tabacum (common tobacco) TTAGGG Weiss et al, 2002
Solanum lycopersicum (tomato) TT[T/A]GGG Ganal et al, 1991
Strombosia pustulata (Italian olive ash) TTTTAGGG Teixeria et al, 2005
Arabidopsis thaliana (thale cress) TTTAGGG Richards et al, 1988
  Aloe sp. TTAGGG Weiss et al, 2002
Hyacinthella dalmatica TTAGGG Puizina et al, 2003
Othocallis siberica (Siberian squill) TTAGGG Weiss-Schneeweiss et al, 2004

  Algae Sequences References
  Cyanidioschyzon merolae (red algae) AATGGGGGG Nozaki et al, 2007
  Chlamydomonas reinhardtii (green alga) TTTTAGGG Petracek et al, 1990

  Ciliates Sequences References
Oligohymenophorea Glaucoma chattoni TTGGGG Katzen et al, 1981
Tetrahymena thermophila TTGGGG Blackburn et al, 1978
Paramecium tetraurelia TT[T/G]GGG Forney et al, 1988
Paramecium primaurelia TT[T/G]GGG Forney et al, 1988
Paramecium multimicronucleatum TT[T/G]GGG Forney et al, 1988
Paramecium caudatum TT[T/G]GGG Forney et al, 1988
Spirotrich Euplotes aediculatus TTTTGGGG Klobutcher et al, 1981
Euplotes eurystomus TTTTGGGG Klobutcher et al, 1981
Euplotes crassus TTTTGGGG Klobutcher et al, 1981
Oxytricha nova (Sterkiella nova) TTTTGGGG Klobutcher et al, 1981
Oxytricha trifallax (Sterkiella histriomuscorum) TTTTGGGG Klobutcher et al, 1981

  Other Protists Sequences References
  Plasmodium falciparum (human parasite) TT[T/C]AGGG Vernick et al, 1988
Plasmodium berghei (rodent parasite) TT[T/C]AGGG Ponzi et al, 1985
Theileria annulata TTTTAGGG Sohanpal et al, 1995
Cryptosporidium parvum TTTAGG Liu et al, 1998
  Giardia lamblia TTAGG Morrison et al, 2007
Giardia intestinalis TAGGG Le Blancq et al, 1991
  Leishmania major TTAGGG Teixeria et al, 2005
Trypanosoma brucei TTAGGG Blackburn et al, 1984