Below is an overview of the sequences that are included within the database grouped by component, telomerase RNA (TR), reverse transcriptase (TERT), associated proteins, and the telomere sequences. The sequences are further organized by taxon. The genbank accession numbers are linked to the record at the National Center for Biotechnology Information (NCBI). The headings of each table are linked to additional pages within the database detailing each sequence. The GC% content is not provided for putative/partial sequences. The GC% content has been adjusted, where necessary, to account for any adjustment to the 5' or 3' ends compared to the NCBI record, numbers in parentheses. The headings at the top of each table are linked to more detailed information for sequence for the particular telomerase component. The heading is omitted, in white, where there are currently no known sequences.
Vertebrates
Vertebrates | TR | TERT | Others components | Telomere sequences | |
---|---|---|---|---|---|
Mammals | Homo sapiens (human) | U85256/NR_001566 | NM_198253 | hEst1A | TTAGGG |
hEst1B | |||||
hGar1p | |||||
hNhp2 | |||||
hNop10 | |||||
dyskerin | |||||
SMN | |||||
14-3-3 | |||||
Ku | |||||
La | |||||
Nucleolin | |||||
PinX1 | |||||
Hsp90 | |||||
Hsp23 | |||||
KIP | |||||
knRNP A1 | |||||
hnRNP C1/C2 | |||||
hnRNP D | |||||
L22 | |||||
hStau | |||||
Pan troglodytes (chimpanzee) | XM_001141571 (predicted) | TTAGGG | |||
XM_001141663 (predicted) | |||||
XM_526823 (predicted) | |||||
Macaca mulatta (rhesus monkey) | XM_001096791 (predicted) | TTAGGG | |||
Tupaia glis belangeri (common tree shrew) | AF221912 | TTAGGG | |||
Oryctolagus cuniculus (domestic rabbit) | AF221918 | DQ399677 (TERT-like mRNA) | TTAGGG | ||
Cavia porcellus (domestic guinea pig) | AF221929 | TTAGGG | |||
Chinchilla brevicaudata (short-tailed chinchilla) | AF221937 | TTAGGG | |||
Geomys breviceps (gopher) | AF221930 | TTAGGG | |||
Microtus ochrogaster (prairie vole) | AF221909 | TTAGGG | |||
Cricetulus griseus (Chinese hamster) | AF221928 | TTAGGG | |||
Mesocricetus auratus (golden Syrian hamster) | AF149012 | TTAGGG | |||
Mus musculus (mouse) | AF221922/NR_001579 | AF051911 | TTAGGG | ||
Mus spretus (western wild mouse) | AY058901 | TTAGGG | |||
Mus musculus castaneus (Asian house mouse) | AY058900 | TTAGGG | |||
Rattus norvegicus (Norway rat) | AF221916/NR_001567 | NM_053423 | TTAGGG | ||
Canis familiaris (dog) | AF380351 | TTAGGG | |||
Mustela putorius furo (domestic ferret) | AF221931 | TTAGGG | |||
Procyon lotor (raccoon) | AF221917 | TTAGGG | |||
Felis catus (cat) | AF221939 | AB094676 (partial sequence) | TTAGGG | ||
Bos taurus (cattle) | AF221936/NR_001576 | NM_001046242 | TTAGGG | ||
Muntiacus muntjak vaginalis (barking deer) | AY760074 (partial sequence) | TTAGGG | |||
Sus scrofa (pig) | AF221920 | AY785158 (partial sequence) | TTAGGG | ||
AF221942 (pseudogene) | |||||
Suncus murinus (Asian house shrew) | AF221921 | TTAGGG | |||
Equus caballus (domestic horse) | AF221925 | TTAGGG | |||
Dasypus novemcinctus (armadillo) | AF221906 | TTAGGG | |||
Dasyurus hallucatus (northern quoll) | AF221919 | TTAGGG | |||
Monodelphis domestica (gray opossum) | XM_001369395 (predicted) | TTAGGG | |||
Elephas maximus (Asian elephant) | AF221932 | TTAGGG | |||
Trichechus manatus (Caribbean manatee) | AF221923 | TTAGGG | |||
Birds | Anas platyrhynchos (mallard ducks) | DQ681293 (partial sequence) | TTAGGG | ||
Coturnix japonica (Japanese quail) | DQ681294 | TTAGGG | |||
Gallus gallus (chicken) | AF221938/NR_001594 | AY502592 | TTAGGG | ||
Anodorhynchus hyacinthinus (macaw) | AF221924 | TTAGGG | |||
Chelydra serpentina (snapping turtle) | AF221911 | TTAGGG | |||
Amphibians | Bombina japonica (toad) | AF221913 | TTAGGG | ||
Xenopus laevis (African clawed frog) | AF221908 | AF212299 | TTAGGG | ||
Ceratophrys ornata (ornate horned frog) | AF221926 | TTAGGG | |||
Pyxicephalus adspersus (bull frog) | AF221940 | TTAGGG | |||
Dermophis mexicanus (Mexican caecilian) | AF221934 | TTAGGG | |||
Herpele squalostoma (Congo caecilians) | AF221927 | TTAGGG | |||
Typhlonectes natans (Rio Cauca caecilian) | AF221910 | TTAGGG | |||
Fish | Oryzias latipes (Medaka) | EF569637 | DQ248968 | TTAGGG | |
Oryzias melastigma (Indian medaka) | DQ286654 | TTAGGG | |||
Nothobranchius furzeri (turquoise killifish) | FJ167673 (GRZ) (partial) | FJ167671 (GRZ) | TTAGGG | ||
FJ167674 (MZM-0403) (partial) | FJ167672 (MZM-0403) | ||||
Gasterosteus aculeatus (stickleback) | EF680234 | TTAGGG | |||
Epinephelus coioides (orange-spotted grouper) | DQ317442 | TTAGGG | |||
Takifugu rubripes (Fugu fish) | EF569638 | AY861384 | TTAGGG | ||
Tetraodon nigroviridis (green puffer fish) | EF680233 | CAAE01014577 (putative) | TTAGGG | ||
Danio rerio (zebrafish) | EF569636 | EF202140 | TTAGGG | ||
Rhizoprionodon porosus (sharpnose shark) | AF221915 | TTAGGG | |||
Mustelus canis (smooth dogfish shark) | AF221933 | TTAGGG | |||
Dasyatis sabina (Atlantic stingray) | AF221914 | TTAGGG | |||
Rhinoptera bonasus (cownose ray) | AF221935 | TTAGGG |
Invertebrates
Invertebrates | TR | TERT | Other Components | Telomere sequences | |
---|---|---|---|---|---|
Ciona intestinalis (sea squirt) | EF077623 | TTAGGG | |||
Ciona savignyi (sea squirt) | EF514225 | TTAGGG | |||
Oikopleura dioica (sea squirt) | TTAGGG | ||||
Botryllus schlosseri (star ascidian) | TTAGGG | ||||
Strongylocentrotus purpuratus (purple sea urchin) | JQ684708 | EF611988 (short) additional .seq: |
TTAGGG | ||
FJ615756 (long) additional .seq: | |||||
Donax trunculus (wedgeshell clam) | TTAGGG | ||||
Argopecten irradians (bay scallop) | TTAGGG | ||||
Cassiopeidae sp. (jellyfish) | TTAGGG | ||||
Gammarus pulex (freshwater shrimp) | TTAGG | ||||
Beetles | Stegobium paniceum (drugstore beetle) | TTAGG | |||
Agrilus viridis (beetle) | TTAGG | ||||
Arhopalus coreanus (beetle) | TTAGG | ||||
Spondylis buprestoides (longhorn beetle) | TTAGG | ||||
Leptinotarsa decemlineata (Colorado potato beetle) | TTAGG | ||||
Ips typographus (Spruce bark beetle) | TTAGG | ||||
Graphoderus cinereus (beetle) | TTAGG | ||||
Ampedus sanguineus (beetle) | TTAGG | ||||
Diacanthous undosus (beetle) | TTAGG | ||||
Melanotus legatus (click beetle) | TTAGG | ||||
Mylabris sp. | TCAGG | ||||
Typhaea stercorea | TCAGG | ||||
Silpha obscura (beetle) | TTAGG | ||||
Oryzaephilus surinamensis (grain beetle) | TTAGG | ||||
Palorus ratzeburgii (small-eyed flour beetle) | TCAGG | ||||
Palorus subdepressus | TCAGG | ||||
Palorus genalis | TCAGG | ||||
Palorus ficicola | TCAGG | ||||
Pimelia elevata | TCAGG | ||||
Pimelia criba | TCAGG | ||||
Pimelia monticola | TCAGG | ||||
Tenebrio molitor (yellow mealworm) | TCAGG | ||||
Tenebrio obscurus | TCAGG | ||||
Tribolium castaneum (red flour beetle) | NM_001040706 | TCAGG | |||
Tribolium freemani | TCAGG | ||||
Tribolium confusum | TCAGG | ||||
Tribolium madens | TCAGG | ||||
Tribolium audax | TCAGG | ||||
Tribolium brevicornis | TCAGG | ||||
Tribolium anaphe | TCAGG | ||||
Tribolium destructor | TCAGG | ||||
Flies | Chironomus tentans (fly) | satellite sequence | |||
Anopheles gambiae (African malaria mosquito) | unequal recombination | ||||
Drosophila melanogaster (fruit fly) | retrotransposons | ||||
Drosophila virilis (fly) | retrotransposons satellite sequence | ||||
Apis mellifera (honey bee) | NM_001040681 | TTAGG | |||
Manica yessensis (ant) | TTAGG | ||||
Myrmecia sp. (ant) | TTAGG | ||||
Tapinoma nigerrimum (ant) | TTAGG | ||||
Lepidopterans | Bombyx mori (domestic silkworm) | DQ467676 | TTAGG | ||
Bombyx mandarina (wild silkworm) | DQ467677 | TTAGG | |||
Mamestra brassicae (cabbage moth) | TTAGG | ||||
Papilio xuthus (butterfly) | TTAGG | ||||
Ephestia kuehniella (Mediterranean flour moth) | TTAGG | ||||
Galleria mellonella (wax moth) | TTAGG | ||||
Antheraea pernyi (Chinese oak silkmoth) | TTAGG | ||||
Antheraea yamamai (Japanese oak silkmoth) | TTAGG | ||||
Samia cynthia ricini (Indian silkmoth) | TTAGG | ||||
Agrius convolvuli (morning glory sphinx moth) | TTAGG | ||||
Sialis lutaria (alderfly) | TTAGG | ||||
Stenopsyche japonica (caddisfly) | TTAGG | ||||
Limnephilus decipiens (caddisfly) | TTAGG | ||||
Protidricerus japonicus (owlfly) | TTAGG | ||||
Periplaneta fuliginosa (dusky-brown cockroach) | TTAGG | ||||
Hodotermopsis japonicus (termite) | TTAGG | ||||
Locusta migratoria (migratory locust) | TTAGG | ||||
Diestrammena japonica (camel cricket) | TTAGG | ||||
Nematodes | Ascaris lumbricoides (common roundworm) | TTAGGC | |||
Ascaris suum (pig round worm) | TTAGGC | ||||
Parascaris univalens | TTGCA | ||||
Caenorhabditis elegans | NM_059972 | TTAGGC | |||
NM_059973 (N' truncation) | |||||
Caenorhabditis remanei | DQ178631 | ||||
Caenorhabditis briggsae | CAE66970 (draft sequence) |
Fungi
Fungi | TR | TERT | Others components | Telomere sequences | |
---|---|---|---|---|---|
Schizosaccharomyces pombe (fission yeast) | EU239354 | AF015783 | SpEst1 | G2–8TTAC(A) | |
Saccharomycotina | Saccharomyces cerevisiae (baker's yeast) S288 | NC_001134 (11-1168) | AM296251 | Est1p | T(G)2-3(TG)1-6 |
Est3p | |||||
Ku | |||||
Cdc13p | |||||
Sm proteins | |||||
PinX1/ Gno1p | |||||
Saccharomyces pastorianus (lager yeast) | AY639014 | ||||
Saccharomyces kudriavzevii | AY639012 | AM296265 | |||
Saccharomyces cariocanus | AY639010 | ||||
Saccharomyces bayanus | AY639013 | AM296250 | T(G)2-3(TG)1-6 | ||
Saccharomyces paradoxus | AY639015 | AM296271 | T(G)2-3(TG)1-6 | ||
Saccharomyces mikatae | AY639011 | AM296270 | T(G)2-3(TG)1-6 | ||
Saccharomyces exiguus | T(G)2-3(TG)1-6 | ||||
Saccharomyces dairenensis | TCTGGG(TG)1-3 | ||||
TCTGGGTG | |||||
Saccharomyces castellii | TCTGGGTG | ||||
Saccharomyces kluyveri | GGGTGGACATGCGTACTGTGAGGTCT | ||||
Kluyveromyces lactis | U31465 | CR382123 | ACGGATTTGATTAGGTATGTGGTGT | ||
Kluyveromyces wickerhamii | AY151281 | ||||
Kluyveromyces nonfermentans | AY151280 | ||||
Kluyveromyces marxianus | AY151279 (118-1633) | ||||
Kluyveromyces dobzhanskii | AY151278 | ||||
Kluyveromyces aestuarii | AY151277 | ||||
Candida albicans | EF647866 | XM_712533 | ACGGATGTCTAACTTCTTGGTGT | ||
Candida glabrata | NC_006032 (668084-670574) | XM_444808 (hypothetical) | CTGGGTGCTGTGGGGT | ||
Candida guillermondii | ACTGGTGT | ||||
Candida maltosa | ACGGATGCAGACTCGCTTGGTGT | ||||
Candida metapsilosis | GGTTAGGATGTCCAAAGTATTGA | ||||
Candida orthopsilosis | GGTTAGGATGTAGACAATACTGC | ||||
Candida parapsilosis | GGTCCGGATGTTGATTATACTGA | ||||
Candida pseudotropicalis | ACGGATTTGATTAGTTATGTGGTGT | ||||
Candida sojae | TGTAAGGATGCAAAACCGCTATTCG | ||||
Candida tropicalis | AC/AGGGATGTCACGATCATTGGTTGT | ||||
AAGGATGTCACGATCATTGGTGT | |||||
Debaryomyces hansenii | XM_458163 (hypothetical) | ATGTTGAGGTGTAGGG | |||
Ashbya gossypii (Eremothecium gossypii) | NM_212177 | GTGTGGTGTATGGGTCTCTCAGCG | |||
Lodderomyces elongisporus | XM_001528127 (hypothetical) | CGGTGTAAGGATGCACTTGAAACT | |||
Pichia guilliermondii | XM_001482068 (hypothetical) | ACTGGTGT | |||
Pichia stipitis | GGATCTTTTCACGTCTTGCGGTA | ||||
Yarrowia lipolytica | XM_502732 (hypothetical) | GGACGATTG | |||
Clavispora lusitaniae | TCTTTAGGGAGGTACTGATGT | ||||
Pezizomycotina | Aspergillus fumigatus | XM_743958 | TTAGGG | ||
Aspergillus oryzae | AP007151 (partial sequence) | TTAGGGTCAACA | |||
Aspergillus clavatus | XM_001273296 | ||||
Aspergillus niger | XM_001396218 (hypothetical) | ||||
Aspergillus nidulans | XM_656265 (hypothetical) | TTAGGG | |||
Aspergillus terreus | XM_001213525 (hypothetical) | ||||
Neosartorya fischeri | XM_001261378 | ||||
Histoplasma capsulatum | TTAGGG | ||||
Coccidioides immitis | XM_001240369 (hypothetical) | ||||
Cladosporium fulvum | TTAGGG | ||||
Gibberella zeae | XM_381218 (hypothetical) | ||||
Magnaporthe grisea (rice blast fungus) | XM_363691 (hypothetical) | TTAGGG | |||
Chaetomium globosum | XM_001220720 (hypothetical) | ||||
Podospora anserina | TTAGGG | ||||
Neurospora crassa | XM_958854 (hypothetical) | TTAGGG | |||
Talaromyces stipitatus | XM_002482751 (putative) | ||||
Coprinopsis cinerea | AACS01000191 (hypothetical) | ||||
Cryptococcus neoformans | TTA(G)4-6 | ||||
Ustilago maydis | XM_751815 (hypothetical) | ||||
Encephalitozoon cuniculi | XM_950490 | G[A/GGCCT[C/T]CT | |||
GAGCCTTGTTT | |||||
GAGACGCAGTGTTGCCAGGATG | |||||
Mold | Dictyostelium discoideum | XM_628870 (hypothetical) | AG1-8 | ||
Physarum polycephalum | TTAGGG | ||||
Didymium iridis | TTAGGG |
* The Genbank records have been adjusted for the 5’ and 3’ ends, numbers in parentheses.
Plants
Plants | TR | TERT | Other Components | Telomere sequences | |
---|---|---|---|---|---|
Eudicots | Nicotiana tabacum (common tobacco) | TTAGGG | |||
Solanum lycopersicum (tomato) | TT[T/A]GGG | ||||
Strombosia pustulata (Italian olive ash) | TTTTGGGG | ||||
Arabidopsis thaliana (thale cress) | HQ401284 (TER1) (partial) | AF135454 | TTTAGGG | ||
HQ401285 (TER2) (partial) | |||||
Monocots | Aloe sp. | TTAGGG | |||
Doryanthes excelsa (Gymea lily) | AY790923 | ||||
Hosta rectifolia (day lily) | AY850586 (partial sequence) | ||||
Muscari armeniacum (grape hyacinth) | DQ073065 (partial sequence) | ||||
Ornithogalum virens (hyacinth) | AY850597 (partial sequence) | ||||
Scilla peruviana (Peruvian jacinth) | AY818158 (partial sequence) | ||||
Iris tectorum (Japanese roof Iris) | DQ057997 | ||||
Phragmipedium longifolium | DQ073072 (partial sequence) | ||||
Oryza sativa (rice) | AF288216 | ||||
Hordeum vulgare (barley) | AY363163 (partial sequence) | ||||
Zea mays (maize) | AY818188 |
Algae
Algae | TR | TERT | Other Components | Telomere sequences | |
---|---|---|---|---|---|
Galdieria sulphuraria (red algae) | |||||
Cyanidioschyzon merolae (red algae) | AATGGGGGG | ||||
Chlamydomonas reinhardtii (green algae) | TTTTAGGG | ||||
Ostreococcus lucimarinus (green algae) | XM_001417260 (predicted) | ||||
Ostreococcus tauri (green algae) | CR954204 |
Ciliates
Ciliates | TR | TERT | Others components | Telomere sequences | |
---|---|---|---|---|---|
Oligohymenophorea | Glaucoma chattoni | (no Genbank ID available) | TTGGGG | ||
Glaucoma sp. ME60q | AF417612 | ||||
Tetrahymena thermophila | AF399707 | AF062652 | p75 | TTGGGG | |
p65 | |||||
p45 | |||||
p20 | |||||
Tetrahymena malaccensis | (no Genbank ID available) | ||||
Tetrahymena pyriformis | (no Genbank ID available) | ||||
Tetrahymena vorax | U22354 | ||||
Tetrahymena borealis | U22350 | ||||
Tetrahymena silvana | U22353 | ||||
Tetrahymena australis | U22349 | ||||
Tetrahymena pigmentosa | (no Genbank ID available) | ||||
Tetrahymena hyperangularis | (no Genbank ID available) | ||||
Tetrahymena capricornis | U22351 | ||||
Tetrahymena hegewischi | (no Genbank ID available) | ||||
Tetrahymena paravorax | U22352 | ||||
Colpidium striatum | AF417611 | ||||
Colpidium colpoda | AF417610 | ||||
Colpidium campylum | AF417609 | ||||
Paramecium tetraurelia | U45433 | AF515460 | TT[T/G]GGG | ||
Paramecium primaurelia | U45434 | TT[T/G]GGG | |||
U45435 (pseudo gene) | |||||
Paramecium multimicronucleatum | U45436 | TT[T/G]GGG | |||
Paramecium caudatum | U45437 | AB035309 | TT[T/G]GGG | ||
Spirotrich | Euplotes aediculatus | U10565 | EAU95964 | p43 | TTTTGGGG |
Euplotes eurystomus | U10566 | AY303935 (partial sequence) | TTTTGGGG | ||
Euplotes crassus | M33461 | AY267543 (micronuclear) | TTTTGGGG | ||
AY267544 (macronuclear) | |||||
Euplotes raikovi | AY303932 (partial sequence) | ||||
Euplotes rariseta | AY303936 (partial sequence) | ||||
Euplotes minuta | AY303934 (partial sequence) | ||||
Euplotes vannus | AY303933 (partial sequence) | ||||
Oxytricha nova (Sterkiella nova) | U10567 | TTTTGGGG | |||
Oxytricha trifallax (Sterkiella histriomuscorum) | U10568 | AF060230 | TTTTGGGG | ||
Stylonychia mytilis | U10570 | ||||
Stylonychia lemnae | U10569 |
Other Protists
Other Protists | TR | TERT | Other Components | Telomere sequences | |
---|---|---|---|---|---|
Aplicomplexans | Plasmodium falciparum (human parasite) | AL929357 (96976-98058) (putative) | AX112155 (partial sequence) | TT[T/C]AGGG | |
Plasmodium vivax (human parasite) | (PlasmoDB) (putative) | XM_001617019 (hypothetical) | |||
Plasmodium knowlesi (monkey parasite) | (PlasmoDB) (putative) | (PlasmoDB) | |||
Plasmodium berghei (rodent parasite) | (PlasmoDB) (putative) | (PlasmoDB) | TT[T/C]AGGG | ||
Plasmodium chabaudi chabaudi (rodent parasite) | (PlasmoDB) (putative) | XM_737184 (hypothetical) | |||
Plasmodium yoelii yoelii (rodent parasite) | (PlasmoDB) (putative) | XM_719577 (hypothetical) | |||
Plasmodium gallinaceum (chicken parasite) | (PlasmoDB) (putative) | ||||
Theileria annulata | XM_950122 (partial sequence) | TTTTAGGG | |||
Cryptosporidium parvum | AY034376 | TTTAGG | |||
Cryptosporidium hominis | XM_662704 (partial sequence) | ||||
Eimeria tenella | GU271118 | ||||
Toxoplasma gondii | AM055943 (hypothetical) | ||||
Giardia lamblia | XM_773419 (partial sequence) | TTAGG | |||
Giardia intestinalis | AF195121 | TAGGG | |||
Kenetoplastids | Leishmania braziliensis | AY268078 (partial sequence) | |||
Leishmania major | AY232305 (partial sequence) | TTAGGG | |||
Leishmania donovani | AY780672 (partial sequence) | ||||
Leishmania amazonensis | AY232307 | ||||
Leishmania infantum | XM_001469585 | ||||
Trypanosoma cruzi | XM_814105 (partial sequence) | ||||
Trypanosoma brucei | AY904042 | TTAGGG |
* The Genbank records have been adjusted for the 5’ and 3’ ends, numbers in parentheses.
Viruses
Viruses | TR | TERT | Other Components | Telomere Sequences | ||
---|---|---|---|---|---|---|
MDV-1 (Marek’s disease alphaherpesvirus 1) | RB1B | AF331499 (160-601) | ||||
MDV-2 (Marek’s disease alphaherpesvirus 2) | GA | AF147806 (246-691) | ||||
Md5 | AF243438 (1676-2117) | |||||
RM-1 | EF526179 (3436-3877) (reverse complement) |
* The Genbank records have been adjusted for the 5’ and 3’ ends, numbers in parentheses.